Journal: Diabetes

Article Title: Overexpression of circulating soluble Nogo-B improves diabetic kidney disease by protecting the vasculature

doi: 10.2337/db19-0157

Figure Lengend Snippet: Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased total β-catenin levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).

Article Snippet: The following primary antibodies were utilised: Nogo-B (N-terminus, R&D System, Abingdon, UK); NgBR (Abcam, Cambridge, UK); α-tubulin (Santa Cruz Biotechnology, Heidelberg, Germany); β-actin; pan-AKT, GSK3β, phospho-AKT (Ser 473 ), phospho-eNOS (Ser 1177 ), and phospho-GSK3β Ser9 (Cell Signalling, Leiden, The Netherlands); eNOS (Santa Cruz Biotechnology, Heidelberg, Germany); total β-catenin (Proteintech, Manchester, UK).

Techniques: Over Expression

Journal: Cell

Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries

doi: 10.1016/j.cell.2018.08.005

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: UCSC - wgEncodeEH000030 Experimental Models: Cell Lines Human: EBV transformed B-lymphocyte Coriell Cat # GM09236 Human: EBV transformed B-lymphocyte Coriell Cat # GM09237 Human: Fibroblast Coriell Cat # AG06103 Human: EBV transformed B-lymphocyte Coriell Cat # GM04024 Human: Fibroblast Coriell Cat # GM04025 Oligonucleotides See Supp Table 7 for list of 5C primers This paper N/A GAPDH primer F: 5'- CACTAGGCGCTCACTGTTCT -3' R: 5'- GACCAAATCCGTTGACTCCG -3' This paper N/A FMR1 primer F: TACGGCAAATGTGTGCCAAAG R: GTGCTCGCTTTGAGGTGACT This paper N/A Primers for CTCF peak 1 F: TGTTGGCTCTTGAGGGAAACAA R: GTTGCTACAGTCGATGGATGG This paper N/A Primers for CTCF peak 2 F: TCTTGTCTGGCCTGTATGGTT R: CCATATTGCACAATGCAGCTCT This paper N/A Software and Algorithms Bowtie/Bowtie2 Langmead et al., 2009, Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ Python MACS Zhang et al., 2008 https://github.com/taoliu/MACS BEDTools Quinlan 2014 http://code.google.com/p/bedtools/ ICED matrix balancing Imakaev et al., 2012 https://github.com/hiclib/iced MEME Suite Bailey et al, 2009 http://meme-suite.org Quantile normalization Bolstad et al., 2003 https://www.ncbi.nlm.nih.gov/pubmed/12538238 deepTools Ramirez et al., 2016 https://github.com/deeptools/deepTools Open in a separate window KEY RESOURCES TABLE Sanger sequencing of key regions From the CTCF ChIP-seq data, we identified three key peaks where CTCF occupancy was differential around FMR1 between samples from healthy controls and those from patients diagnosed with Fragile X Syndrome.

Techniques: Recombinant, SYBR Green Assay, Multiplex Assay, Isolation, RNA HS Assay, Gel Extraction, Cell Differentiation, Transformation Assay, Software